Home / Products /Genome Editing /gRNA plasmids /hTP73 gRNA1 KO plasmidhTP73 gRNA2 KO plasmidhTP73 gRNA3 KO plasmid

hTP73 gRNA1 KO plasmidhTP73 gRNA2 KO plasmidhTP73 gRNA3 KO plasmid

Catalog Number: GP03789

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTP73 gRNA1 KO plasmidhTP73 gRNA2 KO plasmidhTP73 gRNA3 KO plasmid
gRNA sequence CGCCGGCGACATGGTGTCGAAGG(98,0.7),GGGTCCGGGGTAGTCGGTGTTGG(91,0.67),GGCACGCTGGCGGCGTGCTCTGG(88,0.7)
Gene hTP73
Gene ID 7161
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.