Home / Products /Genome Editing /gRNA plasmids /hTMEM45A gRNA1 KO plasmidhTMEM45A gRNA2 KO plasmid

hTMEM45A gRNA1 KO plasmidhTMEM45A gRNA2 KO plasmid

Catalog Number: GP03822

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTMEM45A gRNA1 KO plasmidhTMEM45A gRNA2 KO plasmid
gRNA sequence CAAAAGCGAACCTGCTATCTTGG(77,0.6),TTCAGAGGTCATGCCCTCCCTGG(67,0.67)
Gene hTMEM45A
Gene ID 55076
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.