Home / Products /Genome Editing /gRNA plasmids /hTHRB gRNA1 KO plasmidhTHRB gRNA2 KO plasmidhTHRB gRNA3 KO plasmid

hTHRB gRNA1 KO plasmidhTHRB gRNA2 KO plasmidhTHRB gRNA3 KO plasmid

Catalog Number: GP03852

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTHRB gRNA1 KO plasmidhTHRB gRNA2 KO plasmidhTHRB gRNA3 KO plasmid
gRNA sequence GTCCAGACCGAGAACACGACTGG(97,0.67),TGCCCAGACCTTCCAAACGGAGG(88,0.65),ACGTGCTGCGCCTCTCTGAATGG(82,0.65)
Gene hTHRB
Gene ID 7068
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.