Home / Products /Genome Editing /gRNA plasmids /hTECR gRNA1 KO plasmidhTECR gRNA2 KO plasmidhTECR gRNA3 KO plasmid

hTECR gRNA1 KO plasmidhTECR gRNA2 KO plasmidhTECR gRNA3 KO plasmid

Catalog Number: GP03872

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTECR gRNA1 KO plasmidhTECR gRNA2 KO plasmidhTECR gRNA3 KO plasmid
gRNA sequence GGCTGTTCTCTTCTTCGAGGTGG(83,0.68),GGTGGCCAAGAAACCTAAAAAGG(79,0.75),GAACTTGAGCTTGTTGGCCCGGG(75,0.76)
Gene hTECR
Gene ID 9524
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.