Home / Products /Genome Editing /gRNA plasmids /hTBXA2R gRNA1 KO plasmidhTBXA2R gRNA2 KO plasmidhTBXA2R gRNA3 KO plasmid

hTBXA2R gRNA1 KO plasmidhTBXA2R gRNA2 KO plasmidhTBXA2R gRNA3 KO plasmid

Catalog Number: GP06686

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTBXA2R gRNA1 KO plasmidhTBXA2R gRNA2 KO plasmidhTBXA2R gRNA3 KO plasmid
gRNA sequence GACGGCTGATCGCCTCGCCCTGG(92,0.78),CCGGCCCACAAACATTACCCTGG(89,0.7),CGCGCCCGCCAGCACGCTCAGGG(89,0.74)
Gene hTBXA2R
Gene ID 6915
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.