Home / Products /Genome Editing /gRNA plasmids /hSTK40 gRNA1 KO plasmidhSTK40 gRNA2 KO plasmid

hSTK40 gRNA1 KO plasmidhSTK40 gRNA2 KO plasmid

Catalog Number: GP03932

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSTK40 gRNA1 KO plasmidhSTK40 gRNA2 KO plasmid
gRNA sequence AGCTGGGGAAACGTCGGCCAGGG(93,0.71),AAGCGGAGAGCATCAGACAGAGG(61,0.78)
Gene hSTK40
Gene ID 83931
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.