Home / Products /Genome Editing /gRNA plasmids /hSTK10 gRNA1 KO plasmidhSTK10 gRNA2 KO plasmid

hSTK10 gRNA1 KO plasmidhSTK10 gRNA2 KO plasmid

Catalog Number: GP06708

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSTK10 gRNA1 KO plasmidhSTK10 gRNA2 KO plasmid
gRNA sequence TGAGCACGTCCGCCGCGACCTGG(96,0.72),CGATCTCCCACACCTCGTTGGGG(95,0.76)
Gene hSTK10
Gene ID 6793
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.