Home / Products /Genome Editing /gRNA plasmids /hSRSF5 gRNA1 KO plasmidhSRSF5 gRNA2 KO plasmid

hSRSF5 gRNA1 KO plasmidhSRSF5 gRNA2 KO plasmid

Catalog Number: GP06818

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSRSF5 gRNA1 KO plasmidhSRSF5 gRNA2 KO plasmid
gRNA sequence GTGGCTGTCGGGTATTCATCGGG(94,0.66),GACGTGGAAAGATTCTTCAAGGG(67,0.76)
Gene hSRSF5
Gene ID 6430
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.