Home / Products /Genome Editing /gRNA plasmids /hSNX3 gRNA1 KO plasmidhSNX3 gRNA2 KO plasmid

hSNX3 gRNA1 KO plasmidhSNX3 gRNA2 KO plasmid

Catalog Number: GP06350

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSNX3 gRNA1 KO plasmidhSNX3 gRNA2 KO plasmid
gRNA sequence AGACCGTGGCTGACACCCGGCGG(87,0.77),TCGATCTCGAGGAAGTTGCTGGG(82,0.66)
Gene hSNX3
Gene ID 8724
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.