Home / Products /Genome Editing /gRNA plasmids /hSLC5A2 gRNA1 KO plasmidhSLC5A2 gRNA2 KO plasmidhSLC5A2 gRNA3 KO plasmid

hSLC5A2 gRNA1 KO plasmidhSLC5A2 gRNA2 KO plasmidhSLC5A2 gRNA3 KO plasmid

Catalog Number: GP04039

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC5A2 gRNA1 KO plasmidhSLC5A2 gRNA2 KO plasmidhSLC5A2 gRNA3 KO plasmid
gRNA sequence TTCCTGCTGGTCATTGGCGTTGG(84,0.76),GTCAGCAGGATTGTCAATCAGGG(82,0.67),GGCAGGCTCGGCACCAGAGATGG(73,0.68)
Gene hSLC5A2
Gene ID 6524
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.