Home / Products /Genome Editing /gRNA plasmids /hSLC35A5 gRNA1 KO plasmidhSLC35A5 gRNA2 KO plasmid

hSLC35A5 gRNA1 KO plasmidhSLC35A5 gRNA2 KO plasmid

Catalog Number: GP07077

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC35A5 gRNA1 KO plasmidhSLC35A5 gRNA2 KO plasmid
gRNA sequence ACAATGTATACATTCCTGCTAGG(73,0.68),TGTGAATGTGTGCTCAGAACTGG(65,0.68)
Gene hSLC35A5
Gene ID 55032
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.