Home / Products /Genome Editing /gRNA plasmids /hSLC19A1 gRNA1 KO plasmidhSLC19A1 gRNA2 KO plasmidhSLC19A1 gRNA3 KO plasmid

hSLC19A1 gRNA1 KO plasmidhSLC19A1 gRNA2 KO plasmidhSLC19A1 gRNA3 KO plasmid

Catalog Number: GP06761

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC19A1 gRNA1 KO plasmidhSLC19A1 gRNA2 KO plasmidhSLC19A1 gRNA3 KO plasmid
gRNA sequence TCATGGCGCAGATACGGCCAGGG(94,0.79),GTAGCACACGAGGTGCCGCCAGG(92,0.71),AAGCAGGTGCCCGTGGAACCTGG(79,0.67)
Gene hSLC19A1
Gene ID 6573
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.