Home / Products /Genome Editing /gRNA plasmids /hSCN5A gRNA1 KO plasmidhSCN5A gRNA2 KO plasmidhSCN5A gRNA3 KO plasmid

hSCN5A gRNA1 KO plasmidhSCN5A gRNA2 KO plasmidhSCN5A gRNA3 KO plasmid

Catalog Number: GP04160

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSCN5A gRNA1 KO plasmidhSCN5A gRNA2 KO plasmidhSCN5A gRNA3 KO plasmid
gRNA sequence TGCTGGTGCCCCGAGGTAATAGG(90,0.69),CTCTGCCATGCGCTTCTCGATGG(88,0.74),GGTGGATTGCCATAGAGATCTGG(82,0.75)
Gene hSCN5A
Gene ID 6331
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.