Home / Products /Genome Editing /gRNA plasmids /hROCK1 gRNA1 KO plasmidhROCK1 gRNA2 KO plasmidhROCK1 gRNA3 KO plasmid

hROCK1 gRNA1 KO plasmidhROCK1 gRNA2 KO plasmidhROCK1 gRNA3 KO plasmid

Catalog Number: GP06856

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hROCK1 gRNA1 KO plasmidhROCK1 gRNA2 KO plasmidhROCK1 gRNA3 KO plasmid
gRNA sequence AGATGATCGTTATCTCTACATGG(85,0.67),TGCAGAAGTAGTTCTTGCATTGG(77,0.65),AAGTTTACAAGATCTCCACCAGG(71,0.62)
Gene hROCK1
Gene ID 6093
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.