Home / Products /Genome Editing /gRNA plasmids /hRBM42 gRNA1 KO plasmidhRBM42 gRNA2 KO plasmidhRBM42 gRNA3 KO plasmid

hRBM42 gRNA1 KO plasmidhRBM42 gRNA2 KO plasmidhRBM42 gRNA3 KO plasmid

Catalog Number: GP04253

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRBM42 gRNA1 KO plasmidhRBM42 gRNA2 KO plasmidhRBM42 gRNA3 KO plasmid
gRNA sequence CATCCCGGGCAAAAGCGGCGAGG(97,0.78),TCCTGCACCCGGGAGTCCCGGGG(80,0.82),GTGGTCCCGGGTCCTGGCGCTGG(66,0.76)
Gene hRBM42
Gene ID 79171
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.