Home / Products /Genome Editing /gRNA plasmids /hRAB27A gRNA1 KO plasmidhRAB27A gRNA2 KO plasmidhRAB27A gRNA3 KO plasmid

hRAB27A gRNA1 KO plasmidhRAB27A gRNA2 KO plasmidhRAB27A gRNA3 KO plasmid

Catalog Number: GP04281

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRAB27A gRNA1 KO plasmidhRAB27A gRNA2 KO plasmidhRAB27A gRNA3 KO plasmid
gRNA sequence GTACTTTACCAATATACAGATGG(72,0.72),GCCCACTGTTGTGATAAATTTGG(74,0.6),GCTTTGGGAGACTCTGGTGTAGG(65,0.74)
Gene hRAB27A
Gene ID 5873
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.