Home / Products /Genome Editing /gRNA plasmids /hPPP2R1B gRNA1 KO plasmidhPPP2R1B gRNA2 KO plasmid

hPPP2R1B gRNA1 KO plasmidhPPP2R1B gRNA2 KO plasmid

Catalog Number: GP04381

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP2R1B gRNA1 KO plasmidhPPP2R1B gRNA2 KO plasmid
gRNA sequence TGATTCGCTATACCCGATCGCGG(100,0.8),GGCGCATCAGAGCTCGGGACCGG(93,0.65)
Gene hPPP2R1B
Gene ID 5519
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.