Home / Products /Genome Editing /gRNA plasmids /hPPP1R26 gRNA1 KO plasmidhPPP1R26 gRNA2 KO plasmid

hPPP1R26 gRNA1 KO plasmidhPPP1R26 gRNA2 KO plasmid

Catalog Number: GP06161

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP1R26 gRNA1 KO plasmidhPPP1R26 gRNA2 KO plasmid
gRNA sequence CAGCACTCTGCAGCGCGACGGGG(94,0.72),ATCGCTGCTCACACTGACCGGGG(93,0.74)
Gene hPPP1R26
Gene ID 9858
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.