Home / Products /Genome Editing /gRNA plasmids /hPPM1F gRNA1 KO plasmidhPPM1F gRNA2 KO plasmidhPPM1F gRNA3 KO plasmid

hPPM1F gRNA1 KO plasmidhPPM1F gRNA2 KO plasmidhPPM1F gRNA3 KO plasmid

Catalog Number: GP06188

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPM1F gRNA1 KO plasmidhPPM1F gRNA2 KO plasmidhPPM1F gRNA3 KO plasmid
gRNA sequence GCAAAGTAGGCGCGGTTCACAGG(96,0.65),GTTTGATGGTCACGGAGGCGTGG(90,0.7),CTCTGGCTGGCGGGCAGCGTTGG(75,0.7)
Gene hPPM1F
Gene ID 9647
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.