Home / Products /Genome Editing /gRNA plasmids /hPPIB gRNA1 KO plasmidhPPIB gRNA2 KO plasmid

hPPIB gRNA1 KO plasmidhPPIB gRNA2 KO plasmid

Catalog Number: GP04399

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPIB gRNA1 KO plasmidhPPIB gRNA2 KO plasmid
gRNA sequence CCTTCATGTTGCGTTCGGAGAGG(98,0.67),TTGCCGCCGCCCTCATCGCGGGG(97,0.67)
Gene hPPIB
Gene ID 5479
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.