Home / Products /Genome Editing /gRNA plasmids /hPML gRNA1 KO plasmidhPML gRNA2 KO plasmidhPML gRNA3 KO plasmid

hPML gRNA1 KO plasmidhPML gRNA2 KO plasmidhPML gRNA3 KO plasmid

Catalog Number: GP07150

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPML gRNA1 KO plasmidhPML gRNA2 KO plasmidhPML gRNA3 KO plasmid
gRNA sequence GGAACTCCTCCTCCGAAGCGGGG(95,0.68),GTCGGTGTACCGGCAGATTGTGG(95,0.77),TCTCGAAAAAGACGTTATCCAGG(94,0.71)
Gene hPML
Gene ID 5371
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.