Home / Products /Genome Editing /gRNA plasmids /hPLOD3 gRNA1 KO plasmidhPLOD3 gRNA2 KO plasmidhPLOD3 gRNA3 KO plasmid

hPLOD3 gRNA1 KO plasmidhPLOD3 gRNA2 KO plasmidhPLOD3 gRNA3 KO plasmid

Catalog Number: GP04427

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPLOD3 gRNA1 KO plasmidhPLOD3 gRNA2 KO plasmidhPLOD3 gRNA3 KO plasmid
gRNA sequence TGAAGAACTCCGCAGAGCGCAGG(89,0.76),GTACCCCTCGGTTTCAGCTGTGG(84,0.79),GAAGCTGCTGGTGATCACTGTGG(65,0.79)
Gene hPLOD3
Gene ID 8985
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.