Home / Products /Genome Editing /gRNA plasmids /hPDE4B gRNA1 KO plasmidhPDE4B gRNA2 KO plasmidhPDE4B gRNA3 KO plasmid

hPDE4B gRNA1 KO plasmidhPDE4B gRNA2 KO plasmidhPDE4B gRNA3 KO plasmid

Catalog Number: GP07222

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPDE4B gRNA1 KO plasmidhPDE4B gRNA2 KO plasmidhPDE4B gRNA3 KO plasmid
gRNA sequence ATCCAGTGGACTCCGACCTGGGG(88,0.76),AGAGAAATGACTCTCTGCGCTGG(88,0.68),CGACTATGACTTGTCACCAAAGG(87,0.75)
Gene hPDE4B
Gene ID 5142
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.