Home / Products /Genome Editing /gRNA plasmids /hNPTN gRNA1 KO plasmidhNPTN gRNA2 KO plasmidhNPTN gRNA3 KO plasmid

hNPTN gRNA1 KO plasmidhNPTN gRNA2 KO plasmidhNPTN gRNA3 KO plasmid

Catalog Number: GP04618

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNPTN gRNA1 KO plasmidhNPTN gRNA2 KO plasmidhNPTN gRNA3 KO plasmid
gRNA sequence TTCGTCGCTGCCCAGCGCCCTGG(77,0.76),AGAGACCAGCAACAGCGAGAGGG(73,0.69),TTCTGAGCGGCGCCTGGCCCTGG(65,0.75)
Gene hNPTN
Gene ID 27020
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.