Home / Products /Genome Editing /gRNA plasmids /hNOTCH3 gRNA1 KO plasmidhNOTCH3 gRNA2 KO plasmid

hNOTCH3 gRNA1 KO plasmidhNOTCH3 gRNA2 KO plasmid

Catalog Number: GP04628

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNOTCH3 gRNA1 KO plasmidhNOTCH3 gRNA2 KO plasmid
gRNA sequence TTGCACACGGGCTTCCGTCCAGG(91,0.68),AGGCAGGCAGCCTCCCGGGAGGG(61,0.65)
Gene hNOTCH3
Gene ID 4854
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.