Home / Products /Genome Editing /gRNA plasmids /hNDRG1 gRNA1 KO plasmidhNDRG1 gRNA2 KO plasmid

hNDRG1 gRNA1 KO plasmidhNDRG1 gRNA2 KO plasmid

Catalog Number: GP04673

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNDRG1 gRNA1 KO plasmidhNDRG1 gRNA2 KO plasmid
gRNA sequence TCTGTTCACGTCACGCTGTGTGG(87,0.78),GTTCATGCCGATGTCATGGTAGG(83,0.66)
Gene hNDRG1
Gene ID 10397
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.