Home / Products /Genome Editing /gRNA plasmids /hMTMR2 gRNA1 KO plasmidhMTMR2 gRNA2 KO plasmidhMTMR2 gRNA3 KO plasmid

hMTMR2 gRNA1 KO plasmidhMTMR2 gRNA2 KO plasmidhMTMR2 gRNA3 KO plasmid

Catalog Number: GP04724

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMTMR2 gRNA1 KO plasmidhMTMR2 gRNA2 KO plasmidhMTMR2 gRNA3 KO plasmid
gRNA sequence ATTGGTGGTGCTTCTAGTCGAGG(92,0.85),CTACTCTATTTATCACACCAAGG(81,0.67),GATCTTCTTGTCCGCCCCTCAGG(88,0.69)
Gene hMTMR2
Gene ID 8898
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.