Home / Products /Genome Editing /gRNA plasmids /hMPDU1 gRNA1 KO plasmidhMPDU1 gRNA2 KO plasmidhMPDU1 gRNA3 KO plasmid

hMPDU1 gRNA1 KO plasmidhMPDU1 gRNA2 KO plasmidhMPDU1 gRNA3 KO plasmid

Catalog Number: GP06211

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMPDU1 gRNA1 KO plasmidhMPDU1 gRNA2 KO plasmidhMPDU1 gRNA3 KO plasmid
gRNA sequence AGGCGGACGGACCGCTTAAACGG(98,0.67),ACGACCAACTTTTCGTTCAGTGG(94,0.65),CTCAAGATTCTCCTCAGCAAAGG(66,0.61)
Gene hMPDU1
Gene ID 9526
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.