Home / Products /Genome Editing /gRNA plasmids /hMLST8 gRNA1 KO plasmidhMLST8 gRNA2 KO plasmidhMLST8 gRNA3 KO plasmid

hMLST8 gRNA1 KO plasmidhMLST8 gRNA2 KO plasmidhMLST8 gRNA3 KO plasmid

Catalog Number: GP04762

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMLST8 gRNA1 KO plasmidhMLST8 gRNA2 KO plasmidhMLST8 gRNA3 KO plasmid
gRNA sequence CCTGCCAGAAGCGCACGGTGTGG(89,0.66),GTCCTGGTGCTGCACCGTCCGGG(83,0.81),CCGGTCATCCTGGCCACTGCAGG(62,0.77)
Gene hMLST8
Gene ID 64223
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.