Home / Products /Genome Editing /gRNA plasmids /hMAPK8IP1 gRNA1 KO plasmidhMAPK8IP1 gRNA2 KO plasmidhMAPK8IP1 gRNA3 KO plasmid

hMAPK8IP1 gRNA1 KO plasmidhMAPK8IP1 gRNA2 KO plasmidhMAPK8IP1 gRNA3 KO plasmid

Catalog Number: GP06219

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAPK8IP1 gRNA1 KO plasmidhMAPK8IP1 gRNA2 KO plasmidhMAPK8IP1 gRNA3 KO plasmid
gRNA sequence ACTCATCAGTGATCTCCGAGAGG(88,0.73),CTCCTCCAGGCTGATGTCATGGG(64,0.75),ACAGCTGGTTGGAGGATCAATGG(65,0.67)
Gene hMAPK8IP1
Gene ID 9479
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.