Home / Products /Genome Editing /gRNA plasmids /hMAN1C1 gRNA1 KO plasmidhMAN1C1 gRNA2 KO plasmidhMAN1C1 gRNA3 KO plasmid

hMAN1C1 gRNA1 KO plasmidhMAN1C1 gRNA2 KO plasmidhMAN1C1 gRNA3 KO plasmid

Catalog Number: GP06948

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAN1C1 gRNA1 KO plasmidhMAN1C1 gRNA2 KO plasmidhMAN1C1 gRNA3 KO plasmid
gRNA sequence CAATGACTGTTGCCCCGCTGAGG(89,0.82),CATGAGGTAGAGGGTATCGAGGG(89,0.69),GTGGAAGCTCTCTCCCACCCAGG(60,0.65)
Gene hMAN1C1
Gene ID 57134
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.