Home / Products /Genome Editing /gRNA plasmids /hM6PR gRNA1 KO plasmidhM6PR gRNA2 KO plasmidhM6PR gRNA3 KO plasmid

hM6PR gRNA1 KO plasmidhM6PR gRNA2 KO plasmidhM6PR gRNA3 KO plasmid

Catalog Number: GP07416

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hM6PR gRNA1 KO plasmidhM6PR gRNA2 KO plasmidhM6PR gRNA3 KO plasmid
gRNA sequence AAGAGTTGGCTCTAGTGAAGAGG(79,0.69),GCTACTACTACTCCTGGCTGTGG(74,0.7),GTCCTCCAGCAGCTGTAGAAAGG(68,0.73)
Gene hM6PR
Gene ID 4074
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.