Home / Products /Genome Editing /gRNA plasmids /hL1CAM gRNA1 KO plasmidhL1CAM gRNA2 KO plasmidhL1CAM gRNA3 KO plasmid

hL1CAM gRNA1 KO plasmidhL1CAM gRNA2 KO plasmidhL1CAM gRNA3 KO plasmid

Catalog Number: GP07455

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hL1CAM gRNA1 KO plasmidhL1CAM gRNA2 KO plasmidhL1CAM gRNA3 KO plasmid
gRNA sequence GTCCCATGAGATCCGGCTCATGG(94,0.65),GTGTACCAGTCGCCCCACTCTGG(89,0.65),GGACACCATCCCTCGTCCAGCGG(87,0.78)
Gene hL1CAM
Gene ID 3897
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.