Home / Products /Genome Editing /gRNA plasmids /hKIF1C gRNA1 KO plasmidhKIF1C gRNA2 KO plasmidhKIF1C gRNA3 KO plasmid

hKIF1C gRNA1 KO plasmidhKIF1C gRNA2 KO plasmidhKIF1C gRNA3 KO plasmid

Catalog Number: GP08220

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hKIF1C gRNA1 KO plasmidhKIF1C gRNA2 KO plasmidhKIF1C gRNA3 KO plasmid
gRNA sequence GCTGGTCTCACGGGCGTTAAAGG(98,0.75),GGCTGGTGCCTCGGTGAAAGTGG(84,0.68),CAAGTGTGTGGTCAGCATGCAGG(69,0.8)
Gene hKIF1C
Gene ID 10749
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.