Home / Products /Genome Editing /gRNA plasmids /hKDM7A gRNA1 KO plasmidhKDM7A gRNA2 KO plasmidhKDM7A gRNA3 KO plasmid

hKDM7A gRNA1 KO plasmidhKDM7A gRNA2 KO plasmidhKDM7A gRNA3 KO plasmid

Catalog Number: GP04942

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hKDM7A gRNA1 KO plasmidhKDM7A gRNA2 KO plasmidhKDM7A gRNA3 KO plasmid
gRNA sequence TGGATTTGATGTCCCTATTATGG(81,0.65),CCAGCTGACACAAAGATATCTGG(76,0.68),GTCCCAAAATTAGATGATCTAGG(75,0.66)
Gene hKDM7A
Gene ID 80853
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.