Home / Products /Genome Editing /gRNA plasmids /hKDM1A gRNA1 KO plasmidhKDM1A gRNA2 KO plasmidhKDM1A gRNA3 KO plasmid

hKDM1A gRNA1 KO plasmidhKDM1A gRNA2 KO plasmidhKDM1A gRNA3 KO plasmid

Catalog Number: GP04948

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hKDM1A gRNA1 KO plasmidhKDM1A gRNA2 KO plasmidhKDM1A gRNA3 KO plasmid
gRNA sequence GTCGGACCAGCCGGCGCAAGCGG(98,0.71),CGCGGAGGCTCTTTCTTGCGGGG(93,0.76),CGGACCCCGGCGGTTCCGCCAGG(93,0.65)
Gene hKDM1A
Gene ID 23028
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.