Home / Products /Genome Editing /gRNA plasmids /hPPP1R13L gRNA1 KO plasmidhPPP1R13L gRNA2 KO plasmidhPPP1R13L gRNA3 KO plasmid

hPPP1R13L gRNA1 KO plasmidhPPP1R13L gRNA2 KO plasmidhPPP1R13L gRNA3 KO plasmid

Catalog Number: GP04387

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP1R13L gRNA1 KO plasmidhPPP1R13L gRNA2 KO plasmidhPPP1R13L gRNA3 KO plasmid
gRNA sequence CTAGAAGGGGGTCCGGCCTGCGG(81,0.79),GATGGAGCTGGACACGGCGGCGG(79,0.89),TCAGACTCTCCCGCGCCTCCTGG(79,0.72)
Gene hPPP1R13L
Gene ID 10848
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.