Home / Products /Genome Editing /gRNA plasmids /hITGA6 gRNA1 KO plasmidhITGA6 gRNA2 KO plasmid

hITGA6 gRNA1 KO plasmidhITGA6 gRNA2 KO plasmid

Catalog Number: GP04970

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hITGA6 gRNA1 KO plasmidhITGA6 gRNA2 KO plasmid
gRNA sequence GAGCCCCGGGTACTTATAACTGG(95,0.68),GCAGCATGTTAATACGAAGCAGG(90,0.65)
Gene hITGA6
Gene ID 3655
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.