Home / Products /Genome Editing /gRNA plasmids /hIL13RA1 gRNA1 KO plasmidhIL13RA1 gRNA2 KO plasmidhIL13RA1 gRNA3 KO plasmid

hIL13RA1 gRNA1 KO plasmidhIL13RA1 gRNA2 KO plasmidhIL13RA1 gRNA3 KO plasmid

Catalog Number: GP05007

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hIL13RA1 gRNA1 KO plasmidhIL13RA1 gRNA2 KO plasmidhIL13RA1 gRNA3 KO plasmid
gRNA sequence TTTGAGCTGGCTCCCTCGGGTGG(85,0.77),ACACTCAAATTTGTCACAGGTGG(75,0.76),ATGTCCATATTACTGTGCAGAGG(75,0.68)
Gene hIL13RA1
Gene ID 3597
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.