Home / Products /Genome Editing /gRNA plasmids /hIDH3G gRNA1 KO plasmidhIDH3G gRNA2 KO plasmidhIDH3G gRNA3 KO plasmid

hIDH3G gRNA1 KO plasmidhIDH3G gRNA2 KO plasmidhIDH3G gRNA3 KO plasmid

Catalog Number: GP05029

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hIDH3G gRNA1 KO plasmidhIDH3G gRNA2 KO plasmidhIDH3G gRNA3 KO plasmid
gRNA sequence CCGCCATACTTAGCGGACGGAGG(99,0.74),ACACGGTGACCATGATCCCAGGG(84,0.68),TTGACATGCAGCATGAGCTCTGG(70,0.6)
Gene hIDH3G
Gene ID 3421
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.