Home / Products /Genome Editing /gRNA plasmids /hHTR6 gRNA1 KO plasmidhHTR6 gRNA2 KO plasmidhHTR6 gRNA3 KO plasmid

hHTR6 gRNA1 KO plasmidhHTR6 gRNA2 KO plasmidhHTR6 gRNA3 KO plasmid

Catalog Number: GP05037

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHTR6 gRNA1 KO plasmidhHTR6 gRNA2 KO plasmidhHTR6 gRNA3 KO plasmid
gRNA sequence GTTGGACGTGTTGCGCAGCGCGG(97,0.8),GTGCGTGGTCATCGCGCTGACGG(96,0.66),GAGCGCGATCAGCAGCGAGTTGG(94,0.73)
Gene hHTR6
Gene ID 3362
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.