Home / Products /Genome Editing /gRNA plasmids /hHGF gRNA1 KO plasmidhHGF gRNA2 KO plasmidhHGF gRNA3 KO plasmid

hHGF gRNA1 KO plasmidhHGF gRNA2 KO plasmidhHGF gRNA3 KO plasmid

Catalog Number: GP07577

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHGF gRNA1 KO plasmidhHGF gRNA2 KO plasmidhHGF gRNA3 KO plasmid
gRNA sequence CTGCATAGGGGATGGCGATGGGG(82,0.63),AATGTGCTAATAGATGTACTAGG(73,0.76),TGCTGGATCTATTTTGATTAGGG(68,0.67)
Gene hHGF
Gene ID 3082
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.