Home / Products /Genome Editing /gRNA plasmids /hHDGF gRNA1 KO plasmidhHDGF gRNA2 KO plasmid

hHDGF gRNA1 KO plasmidhHDGF gRNA2 KO plasmid

Catalog Number: GP05086

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHDGF gRNA1 KO plasmidhHDGF gRNA2 KO plasmid
gRNA sequence GTCGCGATCCAACCGGCAGAAGG(98,0.67),GGAGTACAAATGCGGGGACCTGG(89,0.66)
Gene hHDGF
Gene ID 3068
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.