Home / Products /Genome Editing /gRNA plasmids /hGTPBP2 gRNA1 KO plasmidhGTPBP2 gRNA2 KO plasmidhGTPBP2 gRNA3 KO plasmid

hGTPBP2 gRNA1 KO plasmidhGTPBP2 gRNA2 KO plasmidhGTPBP2 gRNA3 KO plasmid

Catalog Number: GP05102

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGTPBP2 gRNA1 KO plasmidhGTPBP2 gRNA2 KO plasmidhGTPBP2 gRNA3 KO plasmid
gRNA sequence TTGAGGGTTCCGCCCACGGCCGG(89,0.71),AGCGGCTGCGGGGGGCCAAAGGG(75,0.69),AGCTGTTCGGCGGCTGCTGCCGG(68,0.74)
Gene hGTPBP2
Gene ID 54676
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.