Home / Products /Genome Editing /gRNA plasmids /hGGCX gRNA1 KO plasmidhGGCX gRNA2 KO plasmidhGGCX gRNA3 KO plasmid

hGGCX gRNA1 KO plasmidhGGCX gRNA2 KO plasmidhGGCX gRNA3 KO plasmid

Catalog Number: GP05162

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGGCX gRNA1 KO plasmidhGGCX gRNA2 KO plasmidhGGCX gRNA3 KO plasmid
gRNA sequence TACGCCCACTGCCACTTGACTGG(90,0.65),GATGGTGCTAGACATTCCCCAGG(84,0.81),GGCACACATCCAGCCCATCAAGG(72,0.64)
Gene hGGCX
Gene ID 2677
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.