Home / Products /Genome Editing /gRNA plasmids /hFLNA gRNA1 KO plasmidhFLNA gRNA2 KO plasmidhFLNA gRNA3 KO plasmid

hFLNA gRNA1 KO plasmidhFLNA gRNA2 KO plasmidhFLNA gRNA3 KO plasmid

Catalog Number: GP05220

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFLNA gRNA1 KO plasmidhFLNA gRNA2 KO plasmidhFLNA gRNA3 KO plasmid
gRNA sequence GGACCGCGAGAGCATCAAACTGG(96,0.74),GCGGCTTATCGCGCTGTTGGAGG(95,0.74),GCAGCTTGAGAACGTGTCGGTGG(92,0.73)
Gene hFLNA
Gene ID 2316
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.