Home / Products /Genome Editing /gRNA plasmids /hFAM20B gRNA1 KO plasmidhFAM20B gRNA2 KO plasmidhFAM20B gRNA3 KO plasmid

hFAM20B gRNA1 KO plasmidhFAM20B gRNA2 KO plasmidhFAM20B gRNA3 KO plasmid

Catalog Number: GP05260

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFAM20B gRNA1 KO plasmidhFAM20B gRNA2 KO plasmidhFAM20B gRNA3 KO plasmid
gRNA sequence AATGATGACTGGCTTGCGGGTGG(89,0.76),TCTTCAGGGTACACTTCCCGGGG(85,0.72),CACTGGGCTGCAATCTCCCAGGG(74,0.74)
Gene hFAM20B
Gene ID 9917
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.