Home / Products /Genome Editing /gRNA plasmids /hERG gRNA1 KO plasmidhERG gRNA2 KO plasmidhERG gRNA3 KO plasmid

hERG gRNA1 KO plasmidhERG gRNA2 KO plasmidhERG gRNA3 KO plasmid

Catalog Number: GP05287

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hERG gRNA1 KO plasmidhERG gRNA2 KO plasmidhERG gRNA3 KO plasmid
gRNA sequence TGCCTACGGAACGCCACACCTGG(97,0.69),AGTCTGTCCATAGTCGCTGGAGG(92,0.89),AGGGACGCGTGGGCTCATCTTGG(88,0.73)
Gene hERG
Gene ID 2078
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.