Home / Products /Genome Editing /gRNA plasmids /hEGFL7 gRNA1 KO plasmidhEGFL7 gRNA2 KO plasmidhEGFL7 gRNA3 KO plasmid

hEGFL7 gRNA1 KO plasmidhEGFL7 gRNA2 KO plasmidhEGFL7 gRNA3 KO plasmid

Catalog Number: GP05331

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hEGFL7 gRNA1 KO plasmidhEGFL7 gRNA2 KO plasmidhEGFL7 gRNA3 KO plasmid
gRNA sequence GCGGCACAGAGCACGCCTACCGG(94,0.67),GCACGAACGACTCGGAGACAGGG(94,0.66),CCCGGACAGCACACACCCTACGG(88,0.65)
Gene hEGFL7
Gene ID 51162
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.