Home / Products /Genome Editing /gRNA plasmids /hCEP57 gRNA1 KO plasmidhCEP57 gRNA2 KO plasmidhCEP57 gRNA3 KO plasmid

hCEP57 gRNA1 KO plasmidhCEP57 gRNA2 KO plasmidhCEP57 gRNA3 KO plasmid

Catalog Number: GP05549

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCEP57 gRNA1 KO plasmidhCEP57 gRNA2 KO plasmidhCEP57 gRNA3 KO plasmid
gRNA sequence TTCGACGCTTGGAACTTGAGAGG(91,0.72),AGCGTCGTAGATCACTATTAAGG(94,0.72),GCTGAGCCATCAAGGTCTAATGG(85,0.68)
Gene hCEP57
Gene ID 9702
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.